Abstract
Hymenolepis are zoonotic cestodes and the house rats are their hosts. According to the previous study through eggs’ morphology analysis, the house rats in Mataram infected with Hymenolepis nana and Hymenolepis diminuta. Since both of the cestodes could also infect a human, therefore the accurate identification will be needed. The aim of the research is to detect the species of Hymenolepis which infect the house rats in Mataram through ITS-1 gene PCR analysis. The rats were trapped and dissected to collect the cestodes. The PCR analysis was done using the forward primer 5’ GCGGAAGGGATACTTACACGTTC 3’ and reverse primer 5’ GCTCGACTCTTCATCGATCCACG 3’. Based on the morphological analysis there are 35 worms samples which assumed as H. nana and H. diminuta. The ITS-1 PCR result showed that only three samples are positive, two samples are positive for H. nana (646 bp) and one sample positive for H. diminuta (748 bp). The other 32 samples have a negative result which possibly due to an error in morphological identification or there is another species of cestodes which have the similar morphological appearance but different in ITS-1 gene such as Raillietina sp. In conclusion, there is an infection of both H. nana and H. diminuta in house rats from Mataram based on the ITS-1 gene PCR analysis.